Gene putatively regulated by attenuation in B_halodurans

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:203 nt.     Distance to run of Ts=0 nt.   Size=37 nt.     Delta G=-12.26 kcal/mol
Antiterminator: Size=23 nt.     Delta G= -3.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tcagtgagccgcgttgtgccgttggaaccacatttgccagcttctttacgtgcatcctctttcgttacctgctttctctacaacgggagaggtttttgtg
acagcttatcatttaacgacaacaggatcggtctattcccttttactcaaatcacaagcagaggcttgtgatttttttaggctctacaataaatgttggg
gtttttgcacaaaagagggcaaaaaaaatgcacgcaggctcctttatccattatccttgaattgccgagaaacaaagaaaggataggagctgcgtgtacg
ATG

    BH0379


Gene: BH0379     GI: 15612942     BI number: BH0379     GOG: COG3464     Description: transposase (01



            t
          t  t
          c  c
          g  t
          t  c
          c  t
          c  a
 ct       a  c
c  c       ta
G  t       ta
T  t       gc
 At        cg
 gc       t  g
 cg       t  g
 at        ta
t  |       cg
 gt        ta
 ta        cg
 gc        cg
            tttttgtgacagcttatcatttaacgacaacaggatcggtctattcccttttactcaaatcacaagcagaggcttgtgatttttttaggctctacaataaatgttggggtttttgcacaaaagagggcaaaaaaaatgcacgcaggctcctttatccattatccttgaattgccgagaaacaaagaaaggataggagctgcgtgtacgATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[L] COG3464 Transposase and inactivated derivatives ... can be seen here

    ..................................................................................................................