                                                                        Gene putatively regulated by attenuation in B_halodurans

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:52 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G= -9.70 kcal/mol
Antiterminator: Size=34 nt.     Delta G=-22.30 kcal/mol
Anti-antiterminator:   Size=48 nt.     Delta G= -7.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGGCTTCTATCCAATCGAAGCTGCAATTACGGGTGGTTTATGTATGGCCAACATGGGT
GGCACAGGAGACGTAGCCGTATTGTCTGCAGCGAAACGGATGCAGCTTATGCCATTTG
CGCAAATTTCCTCTCGCCTTGGAGGCGCGATCATTCTCTTAATTACCGGGTTGATTAT
ACAACTATTCTTGTAAaaagaagagcattgggcgttagcctgatgctcttttccatctggcggaaaagggtttttccacgtcttcctc
gaaattgtaacagaacgcccgtttccgaggagagactaATG

    BH0401 Gene: BH0401     GI: 15612964     BI number: BH0401     GOG: COG2207,COG3449     Description: TA T  T A  A GC TA TA GC GT |  A |  T |  T       tt |  C      g  a G  T       cg C  T       gc CG        gc         t AT       g  t      c  g TA       t  g      t  g TA        ta       a  c |  a       at        cg |  a       cg        cg A  a       gc        ta A  g       at        ta Ta        gc        ta Ta        at        ta Cg        at        cg Ta        gt        tg Cg        at        cg                         tttttccacgtcttcctcgaaattgtaacagaacgcccgtttccgaggagagactaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG2207 AraC-type DNA-binding domain-containing proteins ... can be seen here [L] COG3449 DNA gyrase inhibitor ... can be seen here     ..................................................................................................................