                                                                        Gene putatively regulated by attenuation in B_halodurans

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:129 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-15.60 kcal/mol
Antiterminator: Size=60 nt.     Delta G= -8.72 kcal/mol
Anti-antiterminator:   Size=40 nt.     Delta G= -9.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGTTACCAGCAAGTGGGTTTGTGGCCGATGACAAGCCAAGCCTCGAATTTTGTATGAA
TGATCCTGCCCTTGATCCTGAAGGGAAGGCAAAGGTGGACCTGTATATTCCGATTAGA
AAGAAATAAtgaaatagatacatgcgtctccttaacggaagaggaggcgcttttttaaaaatgatgaatttgtctttatcgaatcatccataaa
aaaacggcatttttagaccatcgtaacggactaaacgagaaaggtagaataggataaactaatacagtttgaatcggtggtgaacggccgTTG

    BH0402 Gene: BH0402     GI: 15612965     BI number: BH0402     GOG: -------     Description:            AG           A  A           A  A           G  A            AT            TA            TA            At           |  g           G  a           C  a           C  a GG       T  t T  A      T  a GC       A  g GC        Ta AT        At A  G       Ta A  T       Gc         g C  A       Ta       c  g G  T      |  t      a  a G  A      |  g      a  a AT       C  c       tg AT        Cg        ta GC        At        cg GC        Gc        cg G  G       Gt        ta A  A      T  |       cg AT        Gc        tg GT        Gc        gc TA        At        cg CG        At        gc                         ttttttaaaaatgatgaatttgtctttatcgaatcatccataaaaaaacggcatttttagaccatcgtaacggactaaacgagaaaggtagaataggataaactaatacagtttgaatcggtggtgaacggccgTTG     ..................................................................................................................