Gene putatively regulated by attenuation in B_halodurans

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:134 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G= -8.20 kcal/mol
Antiterminator: Size=33 nt.     Delta G= -7.10 kcal/mol
Anti-antiterminator:   Size=51 nt.     Delta G=-10.94 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCTTTTTCGGCAAGATCTTCATTAGCTGCCTCTAGTTCCTGATGCTCGTCAATGGAGT
CTCCGACTGGCTTTTGATTCGTACTGTAAGGGCGGCCGTGCTCAACACCGAGCTCCCC
TGATTGATTGGCTTCGGTAGGAAAGGGAAATGTCTTTTTTTGCTTGTTTTTCATtatgct
cacctcatccattagcttgcctgtccgtcgcacgattatgctgggcgtttttgacaacgggtcatgctgtatagttgaggtgcttttttctaacgctatg
gtgagaaaaaaaggggggatttatGTG

    BH0404


Gene: BH0404     GI: 15612967     BI number: BH0404     GOG: -------     Description:


  C
T  A
C  A
 GC
 TA
|  C
 GC
 CG
|  A
 CG        GG
 GC       T  C
 GT       T  T
C  C       AT         A
 GC        GC       A  T
 GC        TG       A  G
 GC        TG        GT
 AT        AT        GC
A  G      G  A       GT
T  A       TG        AT
G  T       CG        AT
T  T      |  A       AT
C  G      |  A       GT
A  A      |  A       GT
T  T       CG        AT
 GT        CG        TG
 CG        CG        GC
 TG        TA        GT
                        TGTTTTTCATtatgctcacctcatccattagcttgcctgtccgtcgcacgattatgctgggcgtttttgacaacgggtcatgctgtatagttgaggtgcttttttctaacgctatggtgagaaaaaaaggggggatttatGTG
    ..................................................................................................................