                                                                        Gene putatively regulated by attenuation in B_halodurans

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:138 nt.    Distance to gene:25 nt.     Distance to run of Ts=2 nt.   Size=23 nt.     Delta G= -7.10 kcal/mol
Antiterminator:    Distance from promoter:124 nt. Size=26 nt.     Delta G= -3.70 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: tcgatt-tatgaa. It has a score value of 62.25 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tcgattactttaccaacatttaatatgaataggttcattttattaatagatgttgaatgatagagaaaacgagcctaaatgaatgaaaacaatagatgat
gtacgcttacattctatttttttaaatctatgattcgtgttaagatttcgatgtttacaacggacccgacttttgtgagagtcaaaagtcacatttttat
aaaaataaaagaaagaggtgctgaaTTG

    BH0414 Gene: BH0414     GI: 15612977     BI number: BH0414     GOG: COG0659     Description: sulfate permeas cc c  g        g a  a      a  a gc       g  g gt       t  t c  t       gc at        ta at        ta cg        ta at        ta tg        cg ta        at tg        gc             acatttttataaaaataaaagaaagaggtgctgaaTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG0659 Sulfate permease and related transporters (MFS superfamily) ... can be seen here     ..................................................................................................................