                                                                        Gene putatively regulated by attenuation in B_halodurans

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:17 nt.     Distance to run of Ts=0 nt.   Size=21 nt.     Delta G=-11.40 kcal/mol
Antiterminator: Size=37 nt.     Delta G= -3.29 kcal/mol
Anti-antiterminator:   Size=35 nt.     Delta G= -8.02 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ACTGAAAGCCGGAAGCTGGTTCAGCGAATGGGCGGTCTATCCAAAGCCTCTGGACATT
GAttgatgaaaaagaggtcgctgtatttcagccgcctttccttgtataagaagagtcaatgagctttattcgagaactcagttttgggcaactacatct
cttttgccctttaaggctaggccttcgttttaagaaaccaatgctttccctatagggcaaacggagagaaagcatgtgagaaataagaatgatgcaatct
gacttggcgacaagccaagtttttttgtaagggagagggaataATG

    BH0415 Gene: BH0415     GI: 15612978     BI number: BH0415     GOG: COG0589     Description:            at   c       a  g g  a      g  a g  a      a  t g  a      a  g a  c      t  c t  g      a  a a  g      a  a ta        at         c cg        gc       a  a c  a       at       g  a cg       g  g       cg ta        ta        gc ta        gc        gc ta       |  t       ta cg       t  t       ta gc       a  g       cg ta        cg        at at        gc        gt                         tttttgtaagggagagggaataATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [T] COG0589 Universal stress protein UspA and related nucleotide-binding proteins ... can be seen here     ..................................................................................................................