                                                                        Gene putatively regulated by attenuation in B_halodurans

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:193 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-15.60 kcal/mol
Antiterminator: Size=37 nt.     Delta G= -5.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGGAGCGTTAGCCATAAAGTAGCGAAGCGTGTAAAATGGCCGGTTATGATTGTAAAAT
AGtgagatctcgcgagcggtgctcctttttaaaggaggagcgctttttttagattattaaactgtgtaagaaaggctctacaataaatgttggggtttt
tgcacaaaagagggcaaaaaaaggctctacaataaatgttggggtttttgcacaaaagagggcaaaaaaaatgcacgcaggctcctttatccattatcct
tgaattgtccagaaacaaagaaaggataggagctgcgtgtacgATG

    BH0416 Gene: BH0416     GI: 15612979     BI number: BH0416     GOG: COG3464     Description: transposase (01 ga c  g gc cg tg c  t t  g        a a  |      t  a gc       t  a at        tg gc        tg t  |       ta Gc        cg At        cg T  |       ta At        cg At        gc At        tg At        gc Ta        gt             ttttttagattattaaactgtgtaagaaaggctctacaataaatgttggggtttttgcacaaaagagggcaaaaaaaggctctacaataaatgttggggtttttgcacaaaagagggcaaaaaaaatgcacgcaggctcctttatccattatccttgaattgtccagaaacaaagaaaggataggagctgcgtgtacgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG3464 Transposase and inactivated derivatives ... can be seen here     ..................................................................................................................