                                                                        Gene putatively regulated by attenuation in B_halodurans

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:64 nt.    Distance to gene:44 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G= -8.80 kcal/mol
Antiterminator:    Distance from promoter:44 nt. Size=29 nt.     Delta G= -3.50 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAAT-TATTTT. It has a score value of 66.93 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAATTTACAGCAGAGAGACATTATTTTGCCAATGAATGTGAACAAGAACTTTCGCA
GTTAAAAGAAGATACATTTCAAGTTGTCATGAACATGCTGAGATAActctcagtatttttagttgt
aaaatgactgatagtcaatcatttatgaggtgatagaATG

    BH0427 Gene: BH0427     GI: 15612990     BI number: BH0427     GOG: COG3965     Description:   T A  G C  A TA GC TA |  T       AA TG       T  c GC        At A  |       Gc AT        At CG        Gc TA        Ta TG        Cg TA        Gt AT        Ta             tttttagttgtaaaatgactgatagtcaatcatttatgaggtgatagaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG3965 Predicted Co/Zn/Cd cation transporters ... can be seen here     ..................................................................................................................