                                                                        Gene putatively regulated by attenuation in B_halodurans

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:130 nt.     Distance to run of Ts=0 nt.   Size=37 nt.     Delta G=-24.50 kcal/mol
Antiterminator: Size=27 nt.     Delta G= -5.40 kcal/mol
Anti-antiterminator:   Size=50 nt.     Delta G=-12.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGACAACCTTGACCATAAAGGATTATGGATGTTAATCCAGTATTTAGAACGGACGAAT
CAACAGACAAAGCAGAAATGGCACGAAGCACTGAACGCTCATTTACGCTTGTCTTAGa
cgagtgctgctctaataaaggcgttagccgcggtggctaacgcctttattttttgtgatttagctaggacaaaagcaggtgtaaagctacatttgcgtct
tgtgtttatggaaaaagggaattcctatcctgacaaggctgtgctaataacggcaaagaacacgattgtggccaactagacatcATG

    BH0436 Gene: BH0436     GI: 15612999     BI number: BH0436     GOG: COG3385     Description: transposase (14   T T  A CG Ta Gc Tg Ta Cg Gt Cg |  c |  t |  g                  g |  c       tt       c  g |  t      g  a      g  t |  c       cg        cg |  t       gc        cg |  a       gc        gc |  a      a  |       at At       a  |       ta Ta       a  |       ta Ta       t  |       gc Ta       a  |       cg A  |      a  |       gc C  |      t  |       gc Tg       c  |       at Cg       t  |       at Gc        cg        at Cg        gc        ta At        tg        at At        cg        at                         ttttgtgatttagctaggacaaaagcaggtgtaaagctacatttgcgtcttgtgtttatggaaaaagggaattcctatcctgacaaggctgtgctaataacggcaaagaacacgattgtggccaactagacatcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG3385 FOG: Transposase and inactivated derivatives ... can be seen here     ..................................................................................................................