                                                                        Gene putatively regulated by attenuation in B_halodurans

This operon is putativelly rgulated by Cobalamin_riboswitch

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:76 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G= -7.60 kcal/mol
Antiterminator: Size=23 nt.     Delta G= -4.10 kcal/mol
Anti-antiterminator:   Size=36 nt.     Delta G=-10.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gacttaatgtttaaaagggaatccggtgcaaatccggagcggtcccgccactgtcatagctgagttgtaacgatattgtcactgaccgttcattggttgg
gaagactgttgcaatgttgacgctagagccaggagacctgcctgttctaacagcactgcttttacctacgggagatagggaggtgtttcaaacatgtttc
gttgcatccaacgaaggatatttttaccactctcccatattggtaaaaatatcctttttattttacctttttactctatcacttcaaggaggaattttac
ATG

    BH0438 --- BH0437 Gene: BH0438     GI: 15613001     BI number: BH0438     GOG: COG0620     Description: homosystein methyl transferase Gene: BH0437     GI: 15613000     BI number: BH0437     GOG: -------     Description: ac t  g cg cg |  a |  g a  a                 at t  t        c       c  c ta       t  a       gc tg        ta        ta tg        ta        ta cg        gc        gc g  a       ta        cg tg        gt        ta cg       g  g       ta at        at        tg cg        gt       g  g gt        gt        ta at        gc        at                         atttttaccactctcccatattggtaaaaatatcctttttattttacctttttactctatcacttcaaggaggaattttacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0620 Methionine synthase II (cobalamin-independent) ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Cobalamin_riboswitch sequence ... can be seen here     ..................................................................................................................