                                                                        Gene putatively regulated by attenuation in B_halodurans

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:128 nt.     Distance to run of Ts=0 nt.   Size=39 nt.     Delta G=-20.80 kcal/mol
Antiterminator: Size=49 nt.     Delta G=-10.50 kcal/mol
Anti-antiterminator:   Size=28 nt.     Delta G= -7.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GATATCGTTCGTGACTATGCGGAGCGTGTTCAAGGCGAATAAaggctactgaatctctgattttcactt
cattacttttctctattagtctattaataggtcgtatctctaggggctcacgatcttgaggttgtccaaaaggggggagagctcccttttgaacaacttt
ttttcctctttaaggactttgcttctgtaaaagatgaaggataagaaaaaattgcacccgccatttacggcttgggtgaaccaagctttctcattttacg
acttaactacttattagaaagttggatttctATG

    BH0440 --- BH0441 --- BH0442 Gene: BH0440     GI: 15613003     BI number: BH0440     GOG: COG3638     Description: transport system protein Gene: BH0441     GI: 15613004     BI number: BH0441     GOG: COG3639     Description: phosphonates transport system (permease) Gene: BH0442     GI: 15613005     BI number: BH0442     GOG: COG3639     Description: phosphonates transport system (permease            tg           t  a            cg            tg            at            gt            cg         g            at       a  a           c  |      g  g           t  |       gc           c  |       gt ta        gc        gc c  g       gc        gc tg       g  a       gc cg       g  a       at tg       a  a       at |  c       ta        at |  t       cg        at a  c       tg        cg ta        cg       c  a gc        tg        ta cg       a  g       gc ta       t  g       ta gt       g  a       ta gc        cg        gc at        ta        gt                         ttttttcctctttaaggactttgcttctgtaaaagatgaaggataagaaaaaattgcacccgccatttacggcttgggtgaaccaagctttctcattttacgacttaactacttattagaaagttggatttctATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG3638 ABC-type phosphate/phosphonate transport system, ATPase component ... can be seen here [P] COG3639 ABC-type phosphate/phosphonate transport system, permease component ... can be seen here [P] COG3639 ABC-type phosphate/phosphonate transport system, permease component ... can be seen here     ..................................................................................................................