                                                                        Gene putatively regulated by attenuation in B_halodurans

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:200 nt.    Distance to gene:22 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G=-12.80 kcal/mol
Antiterminator:    Distance from promoter:135 nt. Size=73 nt.     Delta G=-10.95 kcal/mol
Anti-antiterminator:    Distance from promoter:113 nt.    Size=54 nt.     Delta G=-11.90 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ATGACA-GAAAAT. It has a score value of 60.91 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATGACAAATCTTTTAAAAGAATGGAAAATGCCTCTTGAGCGTACTCATAATAATTCTA
ATCCAGCAGGGGATATTTTCCAAGAGTTAGAAGACCAAGATATTCTAGCTGGGGTGAA
TGGTGCTTGCGCATGGTACAACATCAGCTGCCGTCTAGGTAACAAAGGTGCTTACTGC
ACACTTACAGTTGAGTGCATGCCTTCTTGCAACTAAtacttaacaaaatagagaaagagagtagttacgctac
tctctttctttacatggacaaggagaagaaaATG

    BH0455 --- BH0456 Gene: BH0455     GI: 15613018     BI number: BH0455     GOG: COG4403     Description: lantibiotic mersacidin modifying enzyme Gene: BH0456     GI: 15613019     BI number: BH0456     GOG: -------     Description:            TC           T  T           C  T            CG            GC            TA           |  A           |  C   A       |  T T  C      A  A T  T      C  A CG        Gt GC        Ta TA        Gc GC        At G  A       Gt A  C       Ta A  |       Ta A  |       Gc C  |      A  a AT       C  a AT       A  a TA       T  a GC       T  t |  A      C  a G  G      A  g A  T      C  a        a T  T      A  g      t  c CG       C  a      t  g TA       G  a       gc G  G       Ta        at C  T       Cg        ta CG       A  a       gc GC        Tg        at TA        Ta        gc |  T       Cg        at CG        Gt        gc GC        Ta        at                         ttctttacatggacaaggagaagaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [V] COG4403 Lantibiotic modifying enzyme ... can be seen here     ..................................................................................................................