                                                                        Gene putatively regulated by attenuation in B_halodurans

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:120 nt.    Distance to gene:62 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-10.10 kcal/mol
Antiterminator:    Distance from promoter:94 nt. Size=43 nt.     Delta G= -6.70 kcal/mol
Anti-antiterminator:    Distance from promoter:81 nt.    Size=25 nt.     Delta G= -8.40 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAGT-TACATT. It has a score value of 73.63 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAGTCCAATGGGTATGATGCAGGTTACATTGAAGTGGATGACAGCATGTATGATGT
TGTTCGTGAGACCGCAGAAGCACTAGAGATGAGCGCAGAGGATTTGTTGAACTAGttgg
ggcttcagtagggagaaccaaaaacgtatggacaaagtcaaagggcctcgctgtaggcccctacttttttcacgaataggtgtatataaacagcacgtca
aatttgttttttgaacaggagggtcagcacgATG

    BH0469 --- BH0470 --- BH0471 Gene: BH0469     GI: 15613032     BI number: BH0469     GOG: COG3638     Description: phosphonates transport system Gene: BH0470     GI: 15613033     BI number: BH0470     GOG: COG3639     Description: phosphonates transport system (permease) Gene: BH0471     GI: 15613034     BI number: BH0471     GOG: -------     Description:             g           g  a           t  c           a  a           t  a           g  a            cg        ct            at       g  g           a  c      c  t   t       a  a       ta g  a      a  a       cg a  g      a  a       cg cg        cg        gc tg        cg        gc ta       a  g       gc cg       a  c      a  c g  a       gc       a  t g  a       at       a  | gc        gc       c  | gc       g  g       ta ta        gc        gc ta        at        at                         tttttcacgaataggtgtatataaacagcacgtcaaatttgttttttgaacaggagggtcagcacgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG3638 ABC-type phosphate/phosphonate transport system, ATPase component ... can be seen here [P] COG3639 ABC-type phosphate/phosphonate transport system, permease component ... can be seen here     ..................................................................................................................