                                                                        Gene putatively regulated by attenuation in B_halodurans

This operon is putativelly rgulated by Cobalamin_riboswitch

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:24 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G= -9.30 kcal/mol
Antiterminator: Size=48 nt.     Delta G=-11.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

aaatccggagctgtccccgcaactgtgagtgctacgaacggaacgatttgccactgtacatcctctacttcttgagaaatgtatgggaaggcttctaagt
aggtaaagcacgagtcaggagacctgccttacttccacaagtttcgcatcttcgggggttgagcatgtgaggcggcaagtataaggcagtgcgtgtattc
cgactgaaagggagggggacacgcttgtgtattgtactgtcgtttcaagcctttctctcgaaggaaggttttttatttggattgatagggaggaaataag
ATG

    nrdA --- nrdB Gene: nrdA     GI: 15613064     BI number: BH0501     GOG: COG0209     Description: ribonucleoside-diphosphate reductase alpha subunit Gene: nrdB     GI: 15613065     BI number: BH0502     GOG: COG0208     Description: ribonucleoside-diphosphate reductase beta subuni ct a  g t  t gc tg t  t a  t t  t g  | t  | gc ta ta cg gc         c c  |      t  g a  |      c  a c  |       ta a  |       cg gc        tg gt        ta g  t       ta g  t       cg gc        cg at        gt gc        at gt        at             tttatttggattgatagggaggaaataagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [F] COG0209 Ribonucleotide reductase, alpha subunit ... can be seen here [F] COG0208 Ribonucleotide reductase, beta subunit ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Cobalamin_riboswitch sequence ... can be seen here     ..................................................................................................................