                                                                        Gene putatively regulated by attenuation in B_halodurans

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:97 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G=-10.60 kcal/mol
Antiterminator: Size=44 nt.     Delta G= -7.90 kcal/mol
Anti-antiterminator:   Size=51 nt.     Delta G=-15.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGGATGTCAGATCAGTTGAAACAAGAATTGCTTCCTCGCTTTCCATTCGGTCGTCTCG
GTGAGCCAAAGGACGCAGCTAACCTTATTGCCTTCCTTGCAAGCGATGATGCCGAATG
GATTACAGGGCAAGTGATTCATTCTGAAGGCGGCTTCCAAAATACCTTGTGAgcgaactac
gagtctttgaataaaaggctcgtttttcatttcactttagaaaatttacatttaaccgatagtatagataggtctcattaaaccaaaagacccattactt
atatcataaaaggagtgtaaatgTTG

    BH0505 Gene: BH0505     GI: 15613068     BI number: BH0505     GOG: COG0840     Description: methyl-accepting chemotaxis protei   G G  C G  A       TA A  A      A  C CG       A  C AT        AT TG        AT TA        CG AT       C  T GT       T  G GC        TA TA        Cg AT        Gc AT       |  g GC       |  a |  T      |  a |  G      |  c        a |  A      |  t      a  t |  A      |  a      g  a CG       |  c       ta CG       |  g       ta GC       G  a       ta TG        Cg        cg A  G       Gt        tg G  C       Gc        gc T  T       At        at AT        At        gc GC        Gt        cg                         tttttcatttcactttagaaaatttacatttaaccgatagtatagataggtctcattaaaccaaaagacccattacttatatcataaaaggagtgtaaatgTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [NT] COG0840 Methyl-accepting chemotaxis protein ... can be seen here     ..................................................................................................................