Gene putatively regulated by attenuation in B_halodurans

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:156 nt.    Distance to gene:23 nt.     Distance to run of Ts=1 nt.   Size=28 nt.     Delta G=-17.00 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAAA-CACAAT. It has a score value of 70.28 and is shown in blue

TTGAAATGGGAGGACAGCATTACACAATGATTTCTTCTGGTCAGGAGATGGAAATCAT
GCGAATTGAAGAGCACAATGGCTCCCAGTCGCTTGTGAATGCAACAGAAGACGAAATT
GAACAGCTCGTTGCCGCATATGAAATCGCAATAAACGCTGACGAAAACTTCCCAGAAC
AATAAagtaggagccaggtcaaaacgacggcctggcttgttttattcatttaatacaggagggaatcgATG

    BH0506


Gene: BH0506     GI: 15613069     BI number: BH0506     GOG: COG1028     Description: 3-oxoacyl-[acyl-carrier protein] reductas


          ac
         a  g
         a  a
         a  c
          cg
          tg
          gc
          gc
          at
          cg
          cg
          gc
          at
          gt
            gttttattcatttaatacaggagggaatcgATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[IQR] COG1028 Dehydrogenases with different specificities (related to short-chain alcohol dehydrogenases) ... can be seen here

    ..................................................................................................................