                                                                        Gene putatively regulated by attenuation in B_halodurans

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:75 nt.    Distance to gene:145 nt.     Distance to run of Ts=1 nt.   Size=32 nt.     Delta G= -8.40 kcal/mol
Antiterminator:    Distance from promoter:73 nt. Size=18 nt.     Delta G= -3.90 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttggaa-tataac. It has a score value of 62.25 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttggaagtcatatttttgccccgtataactggagctaggactcgcactacaaggcaactgtgacaacgtctatgtgtccacatcgtgtaggagacttagc
gatcattcaataggggatgaaaaaatcccgctgaatattgtttcactttattatatgctcaaaaacaaaacaatcccagaaaatacctagttgacaacga
ttatcattctcaatatacttaaagcgttaactcttcttagtttgttgttaacagtttacaaagatcataagggggctatttcagattATG

    BH0513 --- BH0514 Gene: BH0513     GI: 15613076     BI number: BH0513     GOG: COG1840     Description: iron (III) transport system (iron (III)-binding protein) Gene: BH0514     GI: 15613077     BI number: BH0514     GOG: COG1178     Description: iron (III) transport system (permease            aa           a  a           g  a            ta            at            gc            gc            gc ta       g  g a  g      a  c a  g      t  | cg       a  | tg        at ta        cg at        ta cg        ta ta        at             attgtttcactttattatatgctcaaaaacaaaacaatcccagaaaatacctagttgacaacgattatcattctcaatatacttaaagcgttaactcttcttagtttgttgttaacagtttacaaagatcataagggggctatttcagattATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG1840 ABC-type Fe3+ transport system, periplasmic component ... can be seen here [P] COG1178 ABC-type Fe3+ transport system, permease component ... can be seen here     ..................................................................................................................