                                                                        Gene putatively regulated by attenuation in B_halodurans

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:187 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-13.30 kcal/mol
Antiterminator: Size=49 nt.     Delta G= -4.39 kcal/mol
Anti-antiterminator:   Size=46 nt.     Delta G= -8.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGCAGCCCCAGATATGGATCAAGAAGAGATGATGGCGATTGCTCGTTCAGTCTATGGA
ACCCAAGAAAAATAAtaggagggcaagctcagtcactggatagactgggcttgttttcacttgcacatttaagaaggtttacctacgac
aatgggtgaaaataataaagaaaacgagcgctccgtgaagaggtttagcgatgagtaaggttttttctaaaggtcataatgagaattgacaatgggaggg
aagagtttgataatctagggataagatgtagtgtaggatggtgagcacgagacGTG

    BH0520 Gene: BH0520     GI: 15613083     BI number: BH0520     GOG: COG0787     Description: alanine racemas            AT TG       A  A T  C      A  A AT       A  t GC       A  a CG       G  g GT       A  g GT       A  a T  C       Cg A  A       Cg G  |       Cg TG       |  c AT       |  a GC       |  a       gg AT       A  g      t  a G  A      A  c      c  t A  T       Gt       a  a A  G       Gc        cg G  |       Ta        ta A  |      A  g       gc A  |      T  t       at CG       C  c       cg TA        Ta        tg A  A       Gc        cg GC        At        gc GC        Cg        at                         tgttttcacttgcacatttaagaaggtttacctacgacaatgggtgaaaataataaagaaaacgagcgctccgtgaagaggtttagcgatgagtaaggttttttctaaaggtcataatgagaattgacaatgggagggaagagtttgataatctagggataagatgtagtgtaggatggtgagcacgagacGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG0787 Alanine racemase ... can be seen here     ..................................................................................................................