                                                                        Gene putatively regulated by attenuation in B_halodurans

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:113 nt.     Distance to run of Ts=0 nt.   Size=21 nt.     Delta G=-11.40 kcal/mol
Antiterminator: Size=39 nt.     Delta G= -6.30 kcal/mol
Anti-antiterminator:   Size=20 nt.     Delta G= -5.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGAGGGGAGCGTGTTTATCCTTCATTCAGACGGAGTGAAGGATGAAAAATTCTTGCTA
TACTCTGTGTTAGATTCAACTGTGACTCCAGACCTGTTTATCGAAATGCTGGAAGAGA
AGGGATCTACGGATGACTTAACGATTTTAGTCGGTAAACTGAGTAAGCCTGCTCGATC
GGAGTAGgttttttcacttttgagcaattgaaaactttggtactgtcatcgcctgacggtcttttaccttaatggatgactgtgctatgatgaag
ccaatgttatgtgagatggagagatgtttatATG

    BH0531 Gene: BH0531     GI: 15613094     BI number: BH0531     GOG: COG2183     Description:            TT           T  A            TG            AT            GC            CG           |  G           |  T           |  A           |  A           |  A           A  C        T AC        AT       A  C T  G       TG       G  G CG        TA        CG TA        CG        TA AT        AT        CG G  G      G  A       GT G  A      T  A       TA GC       A  G       CG AT        GC        Cg AT        GC        Gt                         tttttcacttttgagcaattgaaaactttggtactgtcatcgcctgacggtcttttaccttaatggatgactgtgctatgatgaagccaatgttatgtgagatggagagatgtttatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG2183 Transcriptional accessory protein ... can be seen here     ..................................................................................................................