                                                                        Gene putatively regulated by attenuation in B_halodurans

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:175 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-11.60 kcal/mol
Antiterminator: Size=23 nt.     Delta G= -3.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ACCGAAAAGAAGCCGCAAAACGGTTGCAAATTTCGACGAGAAAGCTCCGATATCTTTT
AAATGAAAAAGTGAATACAGAATAGcgagtagagagctctttatgaaaagggttctttttttatttttaaacccgtttttac
cgatttcgcgaaaagttgtcatgttttgtccaagaatacggccgtaaagagccgattttttggccgcaaggaagggaactcacatgatgaaagcgctttt
ttgttggcacgattcttgcttgtttaagtagtgaaaccaaaatgaggggagagattttacATG

    BH0538 Gene: BH0538     GI: 15613101     BI number: BH0538     GOG: COG1064     Description: NADP-dependent alcohol dehydrogenas            tg           a  a            ta            ta            ta            cg   a        tg g  g       cg a  a       gt tg        at gc        gc at        at gc        gt c  t       at Gt       t  t At        gt Ta        at At        gt             atttttaaacccgtttttaccgatttcgcgaaaagttgtcatgttttgtccaagaatacggccgtaaagagccgattttttggccgcaaggaagggaactcacatgatgaaagcgcttttttgttggcacgattcttgcttgtttaagtagtgaaaccaaaatgaggggagagattttacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG1064 Zn-dependent alcohol dehydrogenases ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_halodurans                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:182 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G= -9.50 kcal/mol Antiterminator: Size=23 nt.     Delta G= -3.30 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ACCGAAAAGAAGCCGCAAAACGGTTGCAAATTTCGACGAGAAAGCTCCGATATCTTTT AAATGAAAAAGTGAATACAGAATAGcgagtagagagctctttatgaaaagggttctttttttatttttaaacccgtttttac cgatttcgcgaaaagttgtcatgttttgtccaagaatacggccgtaaagagccgattttttggccgcaaggaagggaactcacatgatgaaagcgctttt ttgttggcacgattcttgcttgtttaagtagtgaaaccaaaatgaggggagagattttacATG     BH0538 Gene: BH0538     GI: 15613101     BI number: BH0538     GOG: COG1064     Description: NADP-dependent alcohol dehydrogenas   A        tg A  A      a  a A  A       ta GG        ta TT        ta AG        cg AA        tg A  A       cg TT        gt TA        at TC        gc TA        at             ttttttatttttaaacccgtttttaccgatttcgcgaaaagttgtcatgttttgtccaagaatacggccgtaaagagccgattttttggccgcaaggaagggaactcacatgatgaaagcgcttttttgttggcacgattcttgcttgtttaagtagtgaaaccaaaatgaggggagagattttacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG1064 Zn-dependent alcohol dehydrogenases ... can be seen here     ..................................................................................................................