                                                                        Gene putatively regulated by attenuation in B_halodurans

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:83 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G= -8.50 kcal/mol
Antiterminator: Size=48 nt.     Delta G=-13.90 kcal/mol
Anti-antiterminator:   Size=57 nt.     Delta G=-10.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

caacgagcgaagcatctgccgagaaagcgaccttaggaacaacaacatccatttactttataacgacgcggggtggagcagtctggtagctcgtcgggct
cataacccgaaggtcggcggttcaaatccgtcccccgcaataccaaatatcctcattcgtggaagaatggggattttttactgtcttcttttgtgctggg
gacagatttttgcttttatgcttgggaacggagagaaaatcggctacactaatagaggatgaaacagatcggataagggcttcataaggaggtgatcccc
ATG

    BH0544 --- BH0545 --- BH0546 --- BH0547 --- BH0548 Gene: BH0544     GI: 15613107     BI number: BH0544     GOG: COG0611     Description: thiamin-monophosphate kinase Gene: BH0545     GI: 15613108     BI number: BH0545     GOG: COG0802     Description: - Gene: BH0546     GI: 15613109     BI number: BH0546     GOG: COG1214     Description: glycoprotein endopeptidase Gene: BH0547     GI: 15613110     BI number: BH0547     GOG: COG0456     Description: ribosomal-protein (S18)-alanine acetyltransferase Gene: BH0548     GI: 15613111     BI number: BH0548     GOG: COG0533     Description: glycoprotein endopeptidas   a c  a t  a t  t gc gc cg gt gc c  c t  c gc gc |  g |  c       gg |  a      t  a |  a      g  a |  t       cg |  a       ta |  c       ta |  c       at |  a       cg |  a       tg |  a       cg |  t       cg |  a       ta |  t       at         g |  c      t  t      t  t |  c       at       t  g |  t       at       t  c |  c       at       t  t |  a      c  |       cg at       c  |       tg at        at        tg gc        ta        cg cg       a  c       ta |  t       at        gc cg        cg        ta cg        gt        cg                         atttttgcttttatgcttgggaacggagagaaaatcggctacactaatagaggatgaaacagatcggataagggcttcataaggaggtgatccccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG0611 Thiamine monophosphate kinase ... can be seen here [R] COG0802 Predicted ATPase or kinase ... can be seen here [O] COG1214 Inactive homolog of metal-dependent proteases, putative molecular chaperone ... can be seen here [R] COG0456 Acetyltransferases ... can be seen here [O] COG0533 Metal-dependent proteases with possible chaperone activity ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_halodurans                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:90 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G= -8.50 kcal/mol Antiterminator: Size=48 nt.     Delta G=-13.90 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case caacgagcgaagcatctgccgagaaagcgaccttaggaacaacaacatccatttactttataacgacgcggggtggagcagtctggtagctcgtcgggct cataacccgaaggtcggcggttcaaatccgtcccccgcaataccaaatatcctcattcgtggaagaatggggattttttactgtcttcttttgtgctggg gacagatttttgcttttatgcttgggaacggagagaaaatcggctacactaatagaggatgaaacagatcggataagggcttcataaggaggtgatcccc ATG     BH0544 --- BH0545 --- BH0546 --- BH0547 --- BH0548 Gene: BH0544     GI: 15613107     BI number: BH0544     GOG: COG0611     Description: thiamin-monophosphate kinase Gene: BH0545     GI: 15613108     BI number: BH0545     GOG: COG0802     Description: - Gene: BH0546     GI: 15613109     BI number: BH0546     GOG: COG1214     Description: glycoprotein endopeptidase Gene: BH0547     GI: 15613110     BI number: BH0547     GOG: COG0456     Description: ribosomal-protein (S18)-alanine acetyltransferase Gene: BH0548     GI: 15613111     BI number: BH0548     GOG: COG0533     Description: glycoprotein endopeptidas at a  g g  g ag ag ga gt tt gt ct tt tt aa         g c  c      t  t tt       t  g cg       t  c ct       t  t t  |       cg a  |       tg tc        tg at        cg a  t       ta ac        gc ct        ta ct        cg             atttttgcttttatgcttgggaacggagagaaaatcggctacactaatagaggatgaaacagatcggataagggcttcataaggaggtgatccccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG0611 Thiamine monophosphate kinase ... can be seen here [R] COG0802 Predicted ATPase or kinase ... can be seen here [O] COG1214 Inactive homolog of metal-dependent proteases, putative molecular chaperone ... can be seen here [R] COG0456 Acetyltransferases ... can be seen here [O] COG0533 Metal-dependent proteases with possible chaperone activity ... can be seen here     ..................................................................................................................