                                                                        Gene putatively regulated by attenuation in B_halodurans

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:148 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G=-12.20 kcal/mol
Antiterminator: Size=60 nt.     Delta G= -4.99 kcal/mol
Anti-antiterminator:   Size=48 nt.     Delta G= -4.49 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTTCCCATTTAATGGTTACGGTACCTCTATTACTGCTGTACGAATTTAGCATTTGGGT
ATCACACTTAACATATCGAAAAGTACAAAAGCTAGAGAAACTGAGGCAAGAAGAATAT
AGACAGGAGGAGGGCTAGgcttactagctcttttttctattaacggaaagacaaactcatgataactgtaacagtaaaatgtaatgg
aaaatgttctaacatgggctaaaatcaggacattctaatcgaaaatctgttaagatggataatagttatttcgaaaagcgaaatggtgtgacagatgAT
G

    BH0554 Gene: BH0554     GI: 15613117     BI number: BH0554     GOG: COG0477     Description: multidrug resistance protein (efflux transporter            AG           A  A           G  A           A  T           A  A           C  T           G  A           G  G AC       A  A A  A       GC T  T       TA T  A       CG C  T      A  G A  C      A  A C  G      A  G A  A      G  G C  A      A  A T  A      G  G A  A      A  | T  G       TG G  T       CG         t G  A       GC       c  t GC        AT       g  a TA       A  A       Gc TA       A  G       At TA       A  |       Ta A  A      C  |       Cg CG       A  |       Gc GC        Tg        Gt AT        Gc        Gc TA        At        At TG        At        Gt                         ttttctattaacggaaagacaaactcatgataactgtaacagtaaaatgtaatggaaaatgttctaacatgggctaaaatcaggacattctaatcgaaaatctgttaagatggataatagttatttcgaaaagcgaaatggtgtgacagatgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [GEPR] COG0477 Permeases of the major facilitator superfamily ... can be seen here     ..................................................................................................................