                                                                        Gene putatively regulated by attenuation in B_halodurans

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:45 nt.     Distance to run of Ts=0 nt.   Size=17 nt.     Delta G=-10.10 kcal/mol
Antiterminator: Size=42 nt.     Delta G= -5.20 kcal/mol
Anti-antiterminator:   Size=48 nt.     Delta G= -7.36 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

agaagagaaaaggagggataaaaaGTGGAGACTACTTTAAATGTAAAAGGAATGTCTTGTCAACATTG
TGTGAAAGCAGTTGAAGAAAACGTCGGGCAATTAACAGGGGTAGAAAAAGTTACTGTT
CAGTTAGATAAAGGAACAGTTAATGTGAGCTATAAAGAGGATCAAGTCTCGATTGATA
AAATTAAGGATACAATTGAAGACCAGGGATATGATGTAGAATAAgctttgccgtctcattgacggct
ttttatacgaaatgttatatacctaataggggtatagggaggtgtgagaATG

    BH0557 --- BH0558 Gene: BH0557     GI: 15613120     BI number: BH0557     GOG: COG2217     Description: copper-transporting ATPase Gene: BH0558     GI: 15613121     BI number: BH0558     GOG: COG1937     Description:   T T  A A  A A  G       GT A  G      T  A A  A      A  G T  T      G  A A  A       TA GC        AT TA        TA TA       |  A AT       A  g GT        Gc CG        Gt |  A       Gt TA        At CG        Cg TA       |  c        a GC       |  c      c  t |  C       Cg       t  t |  A       At        cg A  G       Gc        ta A  G      A  |       gc CG        At        cg TA        Gc        cg AT        Ta        gc                         tttttatacgaaatgttatatacctaataggggtatagggaggtgtgagaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG2217 Cation transport ATPase ... can be seen here [S] COG1937 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................