                                                                        Gene putatively regulated by attenuation in B_halodurans

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:39 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-11.30 kcal/mol
Antiterminator: Size=49 nt.     Delta G= -9.60 kcal/mol
Anti-antiterminator:   Size=64 nt.     Delta G=-13.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GAGGAGGCGATAAAGAAGGGAATACGTCGATTACAACAAGCATGGTTTTAAatggcttgagc
ttattagcctcaagtcatttttggtaaagaaagtataactagcgatgtctaacgcagggcacaatcatcattggtccgcaaactcatcatgattcatttt
taagcggggggtcgcccttgttaagtagtttaagaggaagttgttgacaagacgaggatactcgcattaaaatatgactgactgtcagtcatattttgtt
tactgattaaatccttttacaaagaagggagctagaccATG

    BH0579 Gene: BH0579     GI: 15613142     BI number: BH0579     GOG: COG2124     Description: cytochrome P450 hydroxylas tc g  g gc gc gc gt gt cg gt |  t |  a |  a |  g       at |  t      g  a |  a       gc |  g       at |  t       gc at        cg at       a  c ta       g  a ta        at tg        at ta       |  a tg       c  a a  |      a  a        t cg       g  a      c  g ta       t  t      a  t ta        ta        gc a  g       gt        ta g  t       tg        cg t  |       ta        at at        gc        gc cg        at        ta t  t      a  g       at at       g  a       ta cg        gc        at ta        at        at                         ttgtttactgattaaatccttttacaaagaagggagctagaccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [Q] COG2124 Cytochrome P450 ... can be seen here     ..................................................................................................................