                                                                        Gene putatively regulated by attenuation in B_halodurans

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:27 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G=-15.40 kcal/mol
Antiterminator: Size=43 nt.     Delta G=-14.80 kcal/mol
Anti-antiterminator:   Size=47 nt.     Delta G=-16.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tttcgccgatggggctttatactaatgataagaaaatggaaaaaggagggtgtccacATGAAGAAAAGATCGCTTGTTTTTT
TAGCAAAAGGCGTCGGGCACTCGACAGCTGTTTTCTTTCGAACTGCGAATCACGGGAG
AAGTATGTCCAATAGCGGATAAgcgactttgatcctaacgattcgtcagaggatattgtggaaaaacaccacaggtcgctttcc
tgtggttcacattgtacgctcaacaccacaggatgcctgtggtgttttttacttttgtaaaaaggagaggaaggacATG

    BH0585 Gene: BH0585     GI: 15613148     BI number: BH0585     GOG: COG1670     Description: ribosomal-protein (S5)-alanine N-acetyltransferas   c g  t c  t t  t       cg gc       a  c gc       t  t at        gc cg        ta at        ta cg       a  c cg       c  | at       a  | c  |      c  | a  |      t  | a  |       ta a  |       gc         t a  |       gc       a  g a  |       ta        gc gt        gc        gc gc        ta        at ta        cg        cg gc        cg        at ta        ta        cg t  t      t  t       cg at       t  |       at tg        cg        cg at        gc        at                         tttttacttttgtaaaaaggagaggaaggacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG1670 Acetyltransferases, including N-acetylases of ribosomal proteins ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_halodurans                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:181 nt.     Distance to run of Ts=1 nt.   Size=21 nt.     Delta G= -7.60 kcal/mol Antiterminator: Size=29 nt.     Delta G= -4.90 kcal/mol Anti-antiterminator:   Size=44 nt.     Delta G= -4.80 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case tttcgccgatggggctttatactaatgataagaaaatggaaaaaggagggtgtccacATGAAGAAAAGATCGCTTGTTTTTT TAGCAAAAGGCGTCGGGCACTCGACAGCTGTTTTCTTTCGAACTGCGAATCACGGGAG AAGTATGTCCAATAGCGGATAAgcgactttgatcctaacgattcgtcagaggatattgtggaaaaacaccacaggtcgctttcc tgtggttcacattgtacgctcaacaccacaggatgcctgtggtgttttttacttttgtaaaaaggagaggaaggacATG     BH0585 Gene: BH0585     GI: 15613148     BI number: BH0585     GOG: COG1670     Description: ribosomal-protein (S5)-alanine N-acetyltransferas AT c  G a  A c  A cG tA |  A |  A        T |  A      T  T g  G      T  T tA        TA gT        TG gC        GC |  G       TA        CA gC       |  A      G  C aT       |  A       GT gT       |  A       GC g  G       TG        CG aT        CG        TA aT        GC        GC aT        CG       |  A aT       T  |       CG aT        AT        GC gT        GC        GT                         GTTTTCTTTCGAACTGCGAATCACGGGAGAAGTATGTCCAATAGCGGATAAgcgactttgatcctaacgattcgtcagaggatattgtggaaaaacaccacaggtcgctttcctgtggttcacattgtacgctcaacaccacaggatgcctgtggtgttttttacttttgtaaaaaggagaggaaggacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG1670 Acetyltransferases, including N-acetylases of ribosomal proteins ... can be seen here     ..................................................................................................................