                                                                        Gene putatively regulated by attenuation in B_halodurans

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:90 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G=-10.60 kcal/mol
Antiterminator: Size=32 nt.     Delta G= -5.15 kcal/mol
Anti-antiterminator:   Size=54 nt.     Delta G=-16.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTTTCACCGAATAGAAGCAGGCGTCATGCCTCACAACATCGGCTCCATCAACGTGTTG
TTAAAAGCCGGATTCCAAAAAGAAGGACTTGCGAGGAAAAATGTGAAGATCAACGGTC
GCTGGGAGGATCACCAAACGCTAGCCATCCTAGAAGGTGAAACAGTGTCCTGAtgatgttt
gtggagaaaagggacagtatgatgtcccttttttagaaaaagcttgtattatgaagtagagcatgatagattagacgtatacaatatactataatttgta
caatggagattaggtgtgactgtATG

    BH0586 Gene: BH0586     GI: 15613149     BI number: BH0586     GOG: NOG13476     Description:   A C  T C  C GC AT TA CG G  A C  A A  | A  | A  | CG CG AT CG        tg TA       t  t A  A      t  g G  A      g  g G  |      t  a A  |      a  g G  |      g  a       at G  |      t  a      t  g GC       A  a      g  a TA       G  a       at CG        Tg        cg GT        Cg        at CG        Cg        gc T  T       Ta        gc GC        Gc        gc GC        Ta        at                         tttttagaaaaagcttgtattatgaagtagagcatgatagattagacgtatacaatatactataatttgtacaatggagattaggtgtgactgtATG     ..................................................................................................................