                                                                        Gene putatively regulated by attenuation in B_halodurans

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:197 nt.    Distance to gene:29 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-12.30 kcal/mol
Antiterminator:    Distance from promoter:174 nt. Size=36 nt.     Delta G=-11.70 kcal/mol
Anti-antiterminator:    Distance from promoter:138 nt.    Size=45 nt.     Delta G= -9.80 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaca-tacatt. It has a score value of 80.99 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgacaacaccctttaagaggagtacatttatgagcgaaaacataaaaagatactcgtgcacctttaatcgctgaatctctattgagagcgggggaacca
tacctgacagagttgtttctgtcttggggtgaatcttatgttttttataagaagggatactctccatccctaatccgacagctaacctcgtaagcgttga
ttcgagagagggtctcgattttttcaagaccatcttctttgaggtggtcttttattggtgcgatgggagaaaaggagctcaagATG

    BH0597 --- BH0598 Gene: BH0597     GI: 15613160     BI number: BH0597     GOG: COG0569     Description: - Gene: BH0598     GI: 15613161     BI number: BH0598     GOG: COG0168     Description: Na+-transporting ATP synthas   t c  c cg at a  a ta cg gc         t a  |      t  t cg       t  t at        at gt        gc cg       c  a |  a       ta |  t       cg        tt |  t       ta       c  t |  c       gc        tg cg        gc        ta ta       g  a       cg |  g       at        tg a  a       gc        at a  g      |  t       cg ta        at        cg cg        gc        at cg        at        gc cg        gt        at                         tttattggtgcgatgggagaaaaggagctcaagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG0569 K+ transport systems, NAD-binding component ... can be seen here [P] COG0168 Trk-type K+ transport systems, membrane components ... can be seen here     ..................................................................................................................