                                                                        Gene putatively regulated by attenuation in B_halodurans

This operon is putativelly rgulated by Guanine_G-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:156 nt.    Distance to gene:51 nt.     Distance to run of Ts=3 nt.   Size=34 nt.     Delta G=-10.70 kcal/mol
Antiterminator:    Distance from promoter:152 nt. Size=15 nt.     Delta G= -3.60 kcal/mol
Anti-antiterminator:    Distance from promoter:106 nt.    Size=51 nt.     Delta G=-15.90 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAac-taaaat. It has a score value of 89.02 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAaccttttgtcctcgactgataaaatgtttccgtgttttacatgtagatatcatccctttcgtatatacttggagataaggtccaggagtttct
accagatcaccgtaaatgatctgactatgaaggtggaatggctcgatatcttcgtacggaacgtttgtccttgcgtaggatgatggctagaattctgcct
tttatagatggagggggattctagctcttttgttattcgctttgtgaacgatgtgtttttattcttggtaaagggtgatatgaatgATG

    guaA Gene: guaA     GI: 15613170     BI number: BH0607     GOG: COG0518,COG0519     Description: GMP synthetas   t g  t c  t a  g at gc gc c  t at tg                   a gc                 t  g cg                 a  a |  t                t  t ta                  tg tg                  tg cg                  ta ta                  cg at                  cg tg                 g  | a  a       at        tg gt       a  t       cg cg        gc        tg t  |       at        ta cg       t  |       at gc        cg        at gt        gc        gc ta        gc        at                         agctcttttgttattcgctttgtgaacgatgtgtttttattcttggtaaagggtgatatgaatgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [F] COG0518 GMP synthase - Glutamine amidotransferase domain ... can be seen here [F] COG0519 GMP synthase, PP-ATPase domain/subunit ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Guanine_G-box sequence ... can be seen here     ..................................................................................................................