                                                                        Gene putatively regulated by attenuation in B_halodurans

This operon is putativelly rgulated by Guanine_G-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:128 nt.    Distance to gene:55 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-15.80 kcal/mol
Antiterminator:    Distance from promoter:128 nt. Size=16 nt.     Delta G= -3.80 kcal/mol
Anti-antiterminator:    Distance from promoter:82 nt.    Size=51 nt.     Delta G=-21.80 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgacg-tacact. It has a score value of 78.98 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgacggacgctagtgggtttgctacactatttttgaaaaataaatcgaaaacatcatttcgtataatggcaggaatagggcctgcgagtttctaccaag
ctaccgtaaatagcttgactacgaaaataatgggttttttactccttatttgtggtcgagcttcaggtagctttctatctggggcttttttatgaagttc
ttgctcgttttcgaaatggtgacgaatagaaggagaggaactatcgATG

    BH0608 Gene: BH0608     GI: 15613171     BI number: BH0608     GOG: COG2252     Description:   t t  t t  t ta gc gt gc t  c at at ta at a  |                 tt a  |                c  t at                  gc gt                  at cg                  ta at                  gt tg                  gc cg        ag        at at       c  g       cg gc       t  t       tg tg        ta        tg ta        cg        cg cg        gc        gc gc        at        at at        gt        gt                         ttttatgaagttcttgctcgttttcgaaatggtgacgaatagaaggagaggaactatcgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG2252 Permeases ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Guanine_G-box sequence ... can be seen here     ..................................................................................................................