                                                                        Gene putatively regulated by attenuation in B_halodurans

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:165 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G= -8.50 kcal/mol
Antiterminator: Size=10 nt.     Delta G= -3.30 kcal/mol
Anti-antiterminator:   Size=74 nt.     Delta G=-12.17 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AACCATGGATCAGAATGTCTGATTCAGAAGGTGATGGTCTCGGCTGAAGAGAAAATGG
AGGATTATTTAAGAGAGCAAAAAATAGCTGATCTTACCAAGAAAATAGCGGGTGACTG
Atgaagtcggctatttttttgaactaattagagatataaatactctttaaagtctattatatttctttcactggttttctttcggtgaatggctgtgaag
cgcagaatccatcgttggggtgcagctaaccaaaccaagggttcagtcactcaggtgtaaagattaatggaggtgcttaaacgtATG

    BH0657 Gene: BH0657     GI: 15613220     BI number: BH0657     GOG: COG0492     Description: pyridine nucleotide-disulphide oxidoreductase, class I AA A  A A  T A  A CG GC AT G  | A  | G  | A  | A  | T  | T  | T  | A  | TG TA AT GC GT AT |  A GC GC TA                   t A  A                A  g A  G                G  a A  A                 Ta A  A                 Cg G  A                 At A  A                 Gc G  T                 Tg A  A                G  | A  G                G  | GC                 G  | TG                  Cg CG        TG        Gc G  G      G  A       At GT        GC        Ta CG        GT        At TA        CG        At                         tttttgaactaattagagatataaatactctttaaagtctattatatttctttcactggttttctttcggtgaatggctgtgaagcgcagaatccatcgttggggtgcagctaaccaaaccaagggttcagtcactcaggtgtaaagattaatggaggtgcttaaacgtATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [O] COG0492 Thioredoxin reductase ... can be seen here     ..................................................................................................................