                                                                        Gene putatively regulated by attenuation in B_halodurans

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:40 nt.    Distance to gene:153 nt.     Distance to run of Ts=1 nt.   Size=39 nt.     Delta G=-10.70 kcal/mol
Antiterminator:    Distance from promoter:12 nt. Size=45 nt.     Delta G= -5.31 kcal/mol
Anti-antiterminator:   Size=45 nt.     Delta G= -4.30 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaaa-ttgaat. It has a score value of 60.24 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgaaaaataatcttcattaatttttttgaatagatatgtttatatagttaagtaagcgcttacgaacattacatttttgcataactattcaaatggtgg
tggtaaaaatgattgtttgaatgttctgatttttatattatgttatagttttctttgtgattccttcggtttttcctaatgttctttagttgatgagttg
tatacgatgaagaacgttgcataaacattgtatagaaaacagtgagatcgtacgaaaaggaggggataaaATG

    BH0659 --- BH0660 Gene: BH0659     GI: 15613222     BI number: BH0659     GOG: -------     Description: - Gene: BH0660     GI: 15613223     BI number: BH0660     GOG: COG0591     Description: sodium/proline symporte at         a g  a      a  c at       g  a        a tg       c  t      a  a at       a  t      c  t at       t  a       tg gt       t  c       tg ta       c  a       at t  t      g  t       tg t  a      c  t       cg t  t       gt        at t  |       at       a  g ta        at       t  | tg        tg       a  | at        gc        cg at       a  a       gt ta        at        ta ta        ta        ta a  g       ta        ta c  t       gc        ta ta        at        ta ta        ta        at cg        at        cg                         attgtttgaatgttctgatttttatattatgttatagttttctttgtgattccttcggtttttcctaatgttctttagttgatgagttgtatacgatgaagaacgttgcataaacattgtatagaaaacagtgagatcgtacgaaaaggaggggataaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [ER] COG0591 Na+/proline symporter ... can be seen here     ..................................................................................................................