                                                                        Gene putatively regulated by attenuation in B_halodurans

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:213 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-17.80 kcal/mol
Antiterminator: Size=34 nt.     Delta G= -6.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTCAAGAAATTCAAGACGAATTCGAAAAGGCAAAAACGAAAGTCATCTAGtgtgaaagcctgt
cagcatagctggcaggtttttttgttgtcacttccttaccgctcaaatataaataaatatctttattgacagtcaagtattttaaagcttttcctaggat
tttcaaggctagacattcaagactttacaaaatgttctatatttgaggattgatgcaaaaggtgtagatcatttatgataaaagtaggaaaatttatggg
ttcgaaggatcataaatgaaaaggggaggggtaaacgGTG

    BH0661 --- BH0662 Gene: BH0661     GI: 15613224     BI number: BH0661     GOG: COG0457     Description: response regulator aspartate phosphatase Gene: BH0662     GI: 15613225     BI number: BH0662     GOG: -------     Description: CA T  T GC         t AT       a  a A  A       cg A  G       gc Gt        at Cg        cg At        tg A  g       gc A  a       ta A  a       cg A  a       cg Cg        gt Gc        at Gc        at At        at             tttgttgtcacttccttaccgctcaaatataaataaatatctttattgacagtcaagtattttaaagcttttcctaggattttcaaggctagacattcaagactttacaaaatgttctatatttgaggattgatgcaaaaggtgtagatcatttatgataaaagtaggaaaatttatgggttcgaaggatcataaatgaaaaggggaggggtaaacgGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0457 FOG: TPR repeat ... can be seen here     ..................................................................................................................