                                                                        Gene putatively regulated by attenuation in B_halodurans

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:67 nt.     Distance to run of Ts=0 nt.   Size=38 nt.     Delta G=-17.20 kcal/mol
Antiterminator: Size=40 nt.     Delta G= -5.43 kcal/mol
Anti-antiterminator:   Size=58 nt.     Delta G=-14.46 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CATCTTGCAGGATTAGCGTTAAGAGGGGAGCACATTAAGCACCCAAAAGTATTATACG
TGCAGGCGAATCGGATTAAAGTGCAGGCAGAAAAAAGCATGCAGCTCAATTTCGATGG
CGAATATGGCGGGCTTCTCCCTGCTGAATTCGTTAACTTATATCAGCATTTTCAGATG
CTATGCCCGAAAGACTGAattagaagtctgagcccaatggttcaggctttttgttttttatagttgtgacgaccacctaattagatt
ataatctaattaggtgattgtctaaatggaggtttctttATG

    BH0677 Gene: BH0677     GI: 15613240     BI number: BH0677     GOG: COG0640,COG3860     Description:   A T  A T  C G  T C  T T  A T  T A  A AT GC TA         A CG       A  G GC       A  A       aa TA       G  C      c  t |  T      C  T       cg |  T      C  G       cg C  T      C  A       gt C  T      G  a       at C  C      T  t       gc TA        At        ta CG        Ta        cg TA        Cg        tg T  T      |  a       gc CG       G  a       at GC        Tg        at GT        At        gt |  A       Gc        at GT        At       t  t CG        Cg        tg GC        Ta        at GC        Tg        At                         ttttatagttgtgacgaccacctaattagattataatctaattaggtgattgtctaaatggaggtttctttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG0640 Predicted transcriptional regulators ... can be seen here [S] COG3860 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_halodurans                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:74 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-13.80 kcal/mol Antiterminator: Size=40 nt.     Delta G= -5.43 kcal/mol Anti-antiterminator:   Size=16 nt.     Delta G= -4.50 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case CATCTTGCAGGATTAGCGTTAAGAGGGGAGCACATTAAGCACCCAAAAGTATTATACG TGCAGGCGAATCGGATTAAAGTGCAGGCAGAAAAAAGCATGCAGCTCAATTTCGATGG CGAATATGGCGGGCTTCTCCCTGCTGAATTCGTTAACTTATATCAGCATTTTCAGATG CTATGCCCGAAAGACTGAattagaagtctgagcccaatggttcaggctttttgttttttatagttgtgacgaccacctaattagatt ataatctaattaggtgattgtctaaatggaggtttctttATG     BH0677 Gene: BH0677     GI: 15613240     BI number: BH0677     GOG: COG0640,COG3860     Description:             C           C  G           C  A           G  A           T  A           A  G           T  A           C  C           G  T            TG        aa            AA       c  t            Ga        cg           |  t       cg TC       A  t       gt T  A       Ca        at TG        Tg        gc TA        Ta        ta AT        Ta        cg CG        Tg        tg GC        At        gc AT        Cc        at                         ttttgttttttatagttgtgacgaccacctaattagattataatctaattaggtgattgtctaaatggaggtttctttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG0640 Predicted transcriptional regulators ... can be seen here [S] COG3860 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................