                                                                        Gene putatively regulated by attenuation in B_halodurans

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:113 nt.    Distance to gene:21 nt.     Distance to run of Ts=0 nt.   Size=37 nt.     Delta G=-24.20 kcal/mol
Antiterminator:    Distance from promoter:83 nt. Size=45 nt.     Delta G= -7.30 kcal/mol
Anti-antiterminator:    Distance from promoter:75 nt.    Size=23 nt.     Delta G= -7.20 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgact-tataat. It has a score value of 85.01 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgacttgactctggcaaggggcttgctataatgaggggggattaaccgaatagccaaatgttttctagggttccgcttgcaaggcaaggcctggtccga
gagaaaacgcaaaaaagattgtcttttttgtccacggagggagaaaagcccgggagatatcgatacacgatatgtctcgggctttttatatggaaaggag
aatgctatATG

    BH0686 --- BH0685 Gene: BH0686     GI: 15613249     BI number: BH0686     GOG: COG2076     Description: chaperonin Gene: BH0685     GI: 15613248     BI number: BH0685     GOG: COG2076     Description: chaperoni            gg           c  a           a  g            cg            cg            ta           g  g            ta         a            ta       t  c            ta       a  a            ta        gc           |  g       cg           |  c       ta           |  c       at   t       |  c       ta t  g      |  g       at a  t      |  g      g  g gc        tg        at at        ta        gc at        cg        gt at        ta        gc at        gt        cg at       t  |       cg at        ta        cg cg        at        gc gt        gc        at                         ttttatatggaaaggagaatgctatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG2076 Membrane transporters of cations and cationic drugs ... can be seen here [P] COG2076 Membrane transporters of cations and cationic drugs ... can be seen here     ..................................................................................................................