                                                                        Gene putatively regulated by attenuation in B_halodurans

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:121 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-13.90 kcal/mol
Antiterminator: Size=24 nt.     Delta G= -3.80 kcal/mol
Anti-antiterminator:   Size=51 nt.     Delta G= -7.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tggtcttttggatgtttgttgttttggggtttaatatatggcttcgtcgttatgctcatcaatttactttatttagaaaagtgatctctcattctttgcg
attggtcaaagctgcaaaactatattttaggatgtgacaatggttaagagtctccatacaatgaggaggctcttttttgttaaaagaaaaatacaatatt
cccttgttcgaatattcctataatggtatatttattgtacaaaagaaaaggaagtcgagagtgaggtgacattctcaaagatacagaaaggatcgaacga
ATG

    BH0694 --- BH0695 Gene: BH0694     GI: 15613257     BI number: BH0694     GOG: COG0640     Description: transcriptional regulator (ArsR family) Gene: BH0695     GI: 15613258     BI number: BH0695     GOG: COG3832     Description: tc g  a g  a ta tg a  c gt cg gc ta ta |  a |  a |  c |  t |  a |  t                  a |  a                c  a |  t       at       a  t |  t      a  g      t  g |  t       cg       a  a |  t       at        cg ta        gt        cg cg        ta        ta tg       |  a       cg ta       |  g       tg at       g  a       gc cg        tg        at t  t       at        gc cg        gc        at ta        gt        at                         ttttgttaaaagaaaaatacaatattcccttgttcgaatattcctataatggtatatttattgtacaaaagaaaaggaagtcgagagtgaggtgacattctcaaagatacagaaaggatcgaacgaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG0640 Predicted transcriptional regulators ... can be seen here [S] COG3832 Uncharacterized conserved protein ... can be seen here     ..................................................................................................................