Gene putatively regulated by attenuation in B_halodurans

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:30 nt.    Distance to gene:118 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-16.60 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGATA-GAAAAT. It has a score value of 66.27 and is shown in blue

TTGATAGGATTTGTACTTTTACGAAAATCAAAAAGAAGAATAGTAGAATAAagaggaaaggg
cctttcgagaacgattgaaaggctctttttgtctcattttaagaaaggccagtagcaacactttttattaattgcaagaaggaacggccacaaaagtcat
agaaatagtgtcaaaaccataaaaaattgtacgaaaggaatgaaccaaTTG

    BH0697


Gene: BH0697     GI: 15613260     BI number: BH0697     GOG: COG3340     Description:


          ac
         a  g
         g  a
          at
          gt
          cg
          ta
          ta
          ta
          cg
          cg
          gc
          gt
          gc
          at
            ttttgtctcattttaagaaaggccagtagcaacactttttattaattgcaagaaggaacggccacaaaagtcatagaaatagtgtcaaaaccataaaaaattgtacgaaaggaatgaaccaaTTG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[E] COG3340 Peptidase E ... can be seen here

    ..................................................................................................................