                                                                        Gene putatively regulated by attenuation in B_halodurans

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:57 nt.    Distance to gene:147 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-16.70 kcal/mol
Antiterminator:    Distance from promoter:31 nt. Size=41 nt.     Delta G= -5.20 kcal/mol
Anti-antiterminator:    Distance from promoter:17 nt.    Size=35 nt.     Delta G= -5.80 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTTACT-TACGAT. It has a score value of 72.29 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTTACTCCTGATGTTGCATGGCTTACGATTTTTACCGTGATTTTATTGTCGCTAAATG
GCCTTACCTCCATTTATGTTTCATTGCGAAAAGGTTGAgtaagcaatctcttacttagcctttttcttttga
accaaacattcctacataaccttaaagtgctgtgacggggtttcgacttcttttcagtagataaaacactaaaccttcgcacttgcatcactgttgtaag
atttaagggtaagccaatcataaaggtaaaggaggttttttgtTTG

    BH0714 Gene: BH0714     GI: 15613277     BI number: BH0714     GOG: COG0178     Description: excinuclease ABC (subunit A            CA           T  T           T  T            TG TA        GC        at T  C       TG       a  c C  C      A  A      c  t C  T       TA        gc GC        TA        at GC        TA        at TA       A  |       ta AT        CG        gc AT        CG        At AT       |  T       Gt TA       |  T       Ta |  T      T  G       Tg CG       C  A       Gc GT        Cg        Gc C  T       At        At T  T       Ta        At GC        Ta        At TA        Cg        At                         tcttttgaaccaaacattcctacataaccttaaagtgctgtgacggggtttcgacttcttttcagtagataaaacactaaaccttcgcacttgcatcactgttgtaagatttaagggtaagccaatcataaaggtaaaggaggttttttgtTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG0178 Excinuclease ATPase subunit ... can be seen here     ..................................................................................................................