                                                                        Gene putatively regulated by attenuation in B_halodurans

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:79 nt.    Distance to gene:89 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G= -9.60 kcal/mol
Antiterminator:    Distance from promoter:21 nt. Size=66 nt.     Delta G= -8.80 kcal/mol
Anti-antiterminator:    Distance from promoter:7 nt.    Size=27 nt.     Delta G=-16.10 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TCGACT-TAAAAT. It has a score value of 66.93 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCGACTTTTTTGATGAGCATTTAAAATAAgacatgagctgccttcaaaccgaaggcagttttttcgtagcaagaacaag
actttcgttctattaaaaaaagaaaacttcacaggactatcggatgagttctgttgaattttgtagaatcggagaaatacattttggcaagaattatcgg
gtttagtataataataacagtttttatagattacatagtgggaggagacagATG

    BH0728 --- BH0729 --- BH0730 --- BH0731 --- BH0732 Gene: BH0728     GI: 15613291     BI number: BH0728     GOG: NOG13149     Description: - Gene: BH0729     GI: 15613292     BI number: BH0729     GOG: NOG13937     Description: - Gene: BH0730     GI: 15613293     BI number: BH0730     GOG: -------     Description: - Gene: BH0731     GI: 15613294     BI number: BH0731     GOG: COG0714     Description: - Gene: BH0732     GI: 15613295     BI number: BH0732     GOG: COG1721     Description:             c           a  t           g  t           a  t           a  c            cg            at            at            gc            at           a  a           c  |            gt            at            ta           g  a           c  a            ta            ta            ta            ta        gg            tg       c  a   a        ta       t  t a  c      g  a      a  g a  c      a  a       ta cg       c  a       cg ta       g  |       at ta        gc        gt cg        at        gc cg        at        at gc        gc        cg ta       |  a      |  t cg       |  c       at gt       |  a       cg at        cg        ta gt        cg        ta                         ttttgtagaatcggagaaatacattttggcaagaattatcgggtttagtataataataacagtttttatagattacatagtgggaggagacagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0714 MoxR-like ATPases ... can be seen here [R] COG1721 Uncharacterized conserved protein (some members contain a von Willebrand factor type A (vWA) domain) ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_halodurans                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:167 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G=-14.20 kcal/mol Antiterminator: Size=40 nt.     Delta G= -3.30 kcal/mol Anti-antiterminator:   Size=48 nt.     Delta G= -6.50 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TGGATGCTGTATTCCCCCCTCTTACTCGACCGTGATCTTCCCATGTTAGATCAAATCA ACAAAACGTTGCTCGACTTTTTTGATGAGCATTTAAAATAAgacatgagctgccttcaaaccgaaggcag ttttttcgtagcaagaacaagactttcgttctattaaaaaaagaaaacttcacaggactatcggatgagttctgttgaattttgtagaatcggagaaata cattttggcaagaattatcgggtttagtataataataacagtttttatagattacatagtgggaggagacagATG     BH0728 --- BH0729 --- BH0730 --- BH0731 --- BH0732 Gene: BH0728     GI: 15613291     BI number: BH0728     GOG: NOG13149     Description: - Gene: BH0729     GI: 15613292     BI number: BH0729     GOG: NOG13937     Description: - Gene: BH0730     GI: 15613293     BI number: BH0730     GOG: -------     Description: - Gene: BH0731     GI: 15613294     BI number: BH0731     GOG: COG0714     Description: - Gene: BH0732     GI: 15613295     BI number: BH0732     GOG: COG1721     Description:   A A  A A  C CG AT AT CG |  C |  T       AA |  C      T  g |  G      A  a |  A      A  c |  C      A  a |  T       At |  T       Tg T  T       Ta AT        Tg AT       |  c        a AT        At       a  c CG        Cg       a  c TA        Gc        cg AT       A  c       ta G  G      G  t       ta A  |      T  |       cg TA        At        cg TG        Gc        gc GC        Ta        ta TA        Ta        cg AT        Ta        gt                         tttttcgtagcaagaacaagactttcgttctattaaaaaaagaaaacttcacaggactatcggatgagttctgttgaattttgtagaatcggagaaatacattttggcaagaattatcgggtttagtataataataacagtttttatagattacatagtgggaggagacagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0714 MoxR-like ATPases ... can be seen here [R] COG1721 Uncharacterized conserved protein (some members contain a von Willebrand factor type A (vWA) domain) ... can be seen here     ..................................................................................................................