                                                                        Gene putatively regulated by attenuation in B_halodurans

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:147 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-11.10 kcal/mol
Antiterminator: Size=16 nt.     Delta G= -3.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GAAGGAAAACTGAAACACGGAGACAACGTCCTTCTTTATGGCTTTGGTGGGGGATTGG
CCCATGCTGGTCTCATTTTGCGTTGGACGGTGCCAACTGAGAAGAACTAAttgcttgtttgat
aacagacatcccatgatgaggtgtctgttttttagcccctttgcttattcgttcgaaatggcgacttggcggacgctttccacggacaacgctccagctt
cctcgagacccccactctcggcgatcttccgctgttgcttttcccgcaggagtcgctgcctgcacgtgtggtgaatgacATG

    BH0765 Gene: BH0765     GI: 15613328     BI number: BH0765     GOG: COG3666     Description:             g           t  a            at            cg           c  a            cg ta        tg a  a       at gc        cg ta        at tg        gc ta        at gc        cg ta        at             tttttagcccctttgcttattcgttcgaaatggcgacttggcggacgctttccacggacaacgctccagcttcctcgagacccccactctcggcgatcttccgctgttgcttttcccgcaggagtcgctgcctgcacgtgtggtgaatgacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG3666 Transposase and inactivated derivatives ... can be seen here     ..................................................................................................................