                                                                        Gene putatively regulated by attenuation in B_halodurans

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:126 nt.     Distance to run of Ts=3 nt.   Size=32 nt.     Delta G=-17.20 kcal/mol
Antiterminator: Size=62 nt.     Delta G=-11.04 kcal/mol
Anti-antiterminator:   Size=37 nt.     Delta G= -6.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GAAACCAACTGATGGCGATTCCTCTGATAAAGTAGCTTCAACACGGGAGGATTGAtatc
tttaccatcaatccttttcggttgcgctagagatctttatttttatagttacatgactgcttacaaagagattcgcctgcctcctgaaaggcaagcgaat
cacctctttttcttccttttcccgtatacgtcaaataagatccgctcccccatatttacccaattcctatcatcttttgattgtttcattaagtcatata
tgttaacatattttctaaaatggttaacatataatcaggagGTG

    BH0783 --- BH0782 Gene: BH0783     GI: 15613346     BI number: BH0783     GOG: COG0132     Description: dethiobiotin synthetase Gene: BH0782     GI: 15613345     BI number: BH0782     GOG: COG0161     Description: denosylmethionine-8-amino-7-oxononanoate aminotransferas            ca           a  t            tg            ta            gc            at            tg           a  c           t  t           t  t           t  a           t  c           t  a           a  a            ta tt        tg t  t       ta c  c       cg cg        ta        tg tg        at       c  a at        gt       c  a at       a  |       ta cg       g  |       cg t  c      a  |       cg a  g      t  |       gc c  c      c  |       ta c  |       gc       c  a at        cg        cg ta        gc        gc tg       |  c       cg ta       t  t       ta cg        tg        ta ta        gc        at at        gc        gc                         acctctttttcttccttttcccgtatacgtcaaataagatccgctcccccatatttacccaattcctatcatcttttgattgtttcattaagtcatatatgttaacatattttctaaaatggttaacatataatcaggagGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG0132 Dethiobiotin synthetase ... can be seen here [H] COG0161 Adenosylmethionine-8-amino-7-oxononanoate aminotransferase ... can be seen here     ..................................................................................................................