                                                                        Gene putatively regulated by attenuation in B_halodurans

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:71 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-19.20 kcal/mol
Antiterminator: Size=42 nt.     Delta G= -7.00 kcal/mol
Anti-antiterminator:   Size=42 nt.     Delta G= -5.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CAGTGCGTACTGAAATTGCTGCGATTTCAAACGTGACGAGCGAATTCTCTCCAGCGCT
GCTGAAAGGTGCTGTAGATCCAGAGGAGTATTTACCACTCTTTAATGACAAGCTGAAC
GAAGCTGGACTGCAAAAAGTGATCGATGAAATGCAGCGCCAATTTGATGAGTGGCAAG
AACTGAATCAATAAtttgttgcagaaaccctgtgcctttacagggtttctgttctttaaagagagctagcattttgcttcggttcagagg
ataatagagttaagttttgtaaaggaggatggcaccATG

    BH0797 Gene: BH0797     GI: 15613360     BI number: BH0797     GOG: COG1940     Description: glucose kinas GA T  T       AA TG       T  t TA        At A  G       At AT        Cg CG       T  t CG       A  t GC       A  g |  A       Gc        ct |  A       Ta       c  t |  G       Cg        gt |  A      |  a       ta C  A      |  a       gc GC       |  a       ta AT       |  c       cg CG       A  c       cg G  A      A  c       cg T  A      G  t       at A  |      A  g       at A  |       At        at AT        Cg        gc GC        Gc        at TA        Gc        cg                         ttctttaaagagagctagcattttgcttcggttcagaggataatagagttaagttttgtaaaggaggatggcaccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [KG] COG1940 Transcriptional regulator/sugar kinase ... can be seen here     ..................................................................................................................