                                                                        Gene putatively regulated by attenuation in B_halodurans

This operon is putativelly rgulated by Cobalamin_riboswitch

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:92 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G= -8.90 kcal/mol
Antiterminator: Size=76 nt.     Delta G=-19.30 kcal/mol
Anti-antiterminator:   Size=53 nt.     Delta G= -8.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gtaataaggagctacatgtgaggaaaccactgtccaaaggatgggaaggtacacatggagtgttgatcttaagtcaggagacctgcctaatgtatgcact
tgcacctacgcgtcatagggaggagtgatagctgttttacatattgtttttaatcgttggattcgtatgctatcacaaactctctttcctatgaaaagag
ggtttgttttgctttaagaagttagtctaagcaacggctttcgctagatgacttgcgacaagccgagttttcaaatgacattgaaagggcggagacatcc
ATG

    BH0798 Gene: BH0798     GI: 15613361     BI number: BH0798     GOG: COG1607     Description: acyl-CoA hydrolas            tt           t  t            gt            ta            ta            at           t  c           a  |            cg            at           t  t           t  g            tg            ta            gt           |  t gg       |  c a  g      |  g t  a      |  t a  g      |  a cg       t  t ta        cg g  |       gc cg        at gt        ta cg        at |  a       gc at        ta ta        gc cg       |  a c  c      |  a        a at       |  a      t  t cg       |  c      c  g gt       |  t      c  a t  t      |  c       ta t  t       at        ta c  t       gc        ta a  a       gt        cg c  |       at        ta gc        gt        cg ta        gc        tg at        gc        cg ta        at        at gt        ta        at                         tgttttgctttaagaagttagtctaagcaacggctttcgctagatgacttgcgacaagccgagttttcaaatgacattgaaagggcggagacatccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [I] COG1607 Acyl-CoA hydrolase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Cobalamin_riboswitch sequence ... can be seen here     ..................................................................................................................