                                                                        Gene putatively regulated by attenuation in B_halodurans

This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:27 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-23.40 kcal/mol
Antiterminator: Size=37 nt.     Delta G=-14.00 kcal/mol
Anti-antiterminator:   Size=53 nt.     Delta G=-11.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
The T-box sequence: ggggtggcaccacg is shown in italic-bold style

tccctttcctcacagaaagcctgtagttgctgagaacgggtaggagagctgtatggaagcaagactctgagcggcacatcggaacaaccctacgccggcc
ggcaagcatttaatccaaaggttgggatggtgtgacaggagctcctgttattgagcaatgtataggctcactatacacatgaggttcatatcgtgatata
tggacgaactggggtggcaccacgacaagtgatcgtccccaagacttttatcagtcttggggacgtttttttgttcataacgcggtaaggaggaaaaaag
GTG

    BH0807 Gene: BH0807     GI: 15613370     BI number: BH0807     GOG: COG0477     Description: tg g  a c  t ta at ta at cg tg ta        ca gc       g  c g  g       gc a  a       ta g  a       gc        ta t  c      g  g      t  t a  |      g  a      t  c c  |       gc        ta at        ta        cg cg       |  a       at a  g       cg        gc t  |       at        at a  |      |  g       at tg       |  a       cg cg        at        cg at        gc        cg cg        cg        cg t  |       at        ta cg        gc        gc gc        gc        cg                         tttttttgttcataacgcggtaaggaggaaaaaagGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [GEPR] COG0477 Permeases of the major facilitator superfamily ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here     ..................................................................................................................