                                                                        Gene putatively regulated by attenuation in B_halodurans

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:145 nt.     Distance to run of Ts=0 nt.   Size=39 nt.     Delta G=-11.30 kcal/mol
Antiterminator: Size=39 nt.     Delta G= -5.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGATTGGGCTGGCGTACGATAATCGAGAGCTATTTGTGCGATCGTCTCTCCCAGCTTG
ACAATATGTTGATACACctctacacctcctccccatttctatcctattgtacgttatgcgaatagagtgaagttgcgcccatgttcgt
gtaatttttctctgagatccgttcagttgatcattttatttaaagaaactaaggcgttttattattttgtttataaccagttaagcgaatgccgtgccct
ttatagtcaaacttcataccgtaatagagaaacttgactaagaggtgatcatgcTTG

    BH0810 Gene: BH0810     GI: 15613373     BI number: BH0810     GOG: COG0860     Description: N-acetylmuramoyl-L-alanine amidas   t g  t       gt c  a      a  t at       a  g tg        gc gc        tg |  g       gc ta       |  c ta       a  c at       g  a ta        at cg        tg c  a       at tg        at at        gc t  |       cg cg        gt ta        tg ta        at tg        ta at        ta             tttttctctgagatccgttcagttgatcattttatttaaagaaactaaggcgttttattattttgtttataaccagttaagcgaatgccgtgccctttatagtcaaacttcataccgtaatagagaaacttgactaagaggtgatcatgcTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG0860 N-acetylmuramoyl-L-alanine amidase ... can be seen here     ..................................................................................................................