                                                                        Gene putatively regulated by attenuation in B_halodurans

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:42 nt.     Distance to run of Ts=0 nt.   Size=21 nt.     Delta G=-10.80 kcal/mol
Antiterminator: Size=44 nt.     Delta G= -7.30 kcal/mol
Anti-antiterminator:   Size=50 nt.     Delta G= -8.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GAAACCCCTGTGGGAGAATTTATTATCATTAACAAAGCACCGAACCCAGGGGGGCCGT
TTGGTACGATGTGGATGTCGTTATCGAAACAGCATACGGAATTCACGGGACAAATGAC
CCGGCTTCAATCGGTCGAGCGGTTTCAAGAGGATGCATTCGGATGTACAATGAAGATG
TGGAAGAATTAGcacgaatggttccaattggtacaccggtttttatccagccatagaaaccagagggcaatgctttctggtttttactaag
attacatataggacaagagaggagacagagaaggtATG

    BH0812 Gene: BH0812     GI: 15613375     BI number: BH0812     GOG: COG0494     Description: ca G  c A  g Ta Ta At         a A  g      t  t G  g      t  c At       t  c At        ta Gc        tg Gc        gc Ta        gc G  |      |  a Ta       c  t At       c  a Gt       a  g A  g      c  a        a A  |      a  a      a  t G  |       ta        cg T  |       gc        gc A  |       gc        gt A  |       ta        gt Cg        tg        at At       a  a       gc Ta       a  g       at Gc        cg        cg Ta        cg        cg                         tttttactaagattacatataggacaagagaggagacagagaaggtATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [LR] COG0494 NTP pyrophosphohydrolases including oxidative damage repair enzymes ... can be seen here     ..................................................................................................................