                                                                        Gene putatively regulated by attenuation in B_halodurans

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:121 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G=-11.30 kcal/mol
Antiterminator: Size=17 nt.     Delta G= -3.60 kcal/mol
Anti-antiterminator:   Size=54 nt.     Delta G= -6.61 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCTCGGATCGATGCCACAACTACAAATGGAAGGAATCATTATCGGTATGAATACAGGT
GTCGTCATGTTGACGCTCATGCATTTACTTACGATTCGCTACAAAATGCAAGAACCCC
AAAGCTGGAAATTATCCAGAGCTTAAaatgaaccgattggcttgccgacgttggcaagctttttcatgccttaaaggaatg
atgatttttgaaaaaatgttaaatgatatgtaatattgtttccttttttgctagtgaccacgtatgatgaaagaaagactcttgagtgataagaggtggt
tgcATG

    BH0823 Gene: BH0823     GI: 15613386     BI number: BH0823     GOG: COG4362     Description: nitric oxide synthas   T A  T A  A AT GC GC TA CG |  A |  G |  C |  T |  T |  A |  A |  a |  a |  t |  g |  a |  a |  c |  c G  g A  a At At Cg                  cg Cg        tt       a  t C  |      c  g       gt C  |       gc        cg A  |       gc        cg A  |       tg        gc Gc        ta        ta At       a  |       ta At        gc        cg Cg        cg        gc                         tttttcatgccttaaaggaatgatgatttttgaaaaaatgttaaatgatatgtaatattgtttccttttttgctagtgaccacgtatgatgaaagaaagactcttgagtgataagaggtggttgcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [PE] COG4362 Nitric oxide synthase, oxygenase domain ... can be seen here     ..................................................................................................................