                                                                        Gene putatively regulated by attenuation in B_halodurans

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:21 nt.     Distance to run of Ts=2 nt.   Size=25 nt.     Delta G=-18.30 kcal/mol

                                                                        Nomenclature/Definitions

CGGTGGGGTCATCGTCTCTTACCTTGAATGGAAGCAGAGCCGGATTACGGAGCTTTAT
TCTGAGGATGATATTTTAGATGAAATGGGAACGCAGATGAAGGAAACGCTAAAATCCG
TCTATGAGCGCTATTTTTCCTCGGTCGGGCATACGCTGCGTTTTACGTGCTTTACGCT
AGCACTTGAACGGCTAACGAGCTTGCTGTATAAGCACGGAAAGCTCTATTAAacgattcag
gccgctccacctcggggtggcctgattgtttctgattgtttttgaacgaaaggggagaaaagcctGTG

    BH0825 Gene: BH0825     GI: 15613388     BI number: BH0825     GOG: NOG13169     Description:            c          c  t          a  c           cg           cg           tg           cg           gt           cg           cg           gc           gc           at             gattgtttctgattgtttttgaacgaaaggggagaaaagcctGTG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_halodurans                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:36 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-22.80 kcal/mol Antiterminator: Size=67 nt.     Delta G=-21.50 kcal/mol Anti-antiterminator:   Size=28 nt.     Delta G=-10.40 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case CGGTGGGGTCATCGTCTCTTACCTTGAATGGAAGCAGAGCCGGATTACGGAGCTTTAT TCTGAGGATGATATTTTAGATGAAATGGGAACGCAGATGAAGGAAACGCTAAAATCCG TCTATGAGCGCTATTTTTCCTCGGTCGGGCATACGCTGCGTTTTACGTGCTTTACGCT AGCACTTGAACGGCTAACGAGCTTGCTGTATAAGCACGGAAAGCTCTATTAAacgattcag gccgctccacctcggggtggcctgattgtttctgattgtttttgaacgaaaggggagaaaagcctGTG     BH0825 Gene: BH0825     GI: 15613388     BI number: BH0825     GOG: NOG13169     Description:            ga           c  t           a  t            Ac            Aa            Tg            Tg           A  c            Tc            Cg            Tc            Ct            Gc            Ac           |  a           A  c            Ac            Gt            G           C           A          c AA        C       c  t T  G       G       a  c A  C      |         cg TA        A        cg GC        A        tg TG        T        cg CG        A        gt G  A       T        cg TA        G        cg TA       |         gc CG       T         gc GC        C        at AT        G        cg GC        T        ta                         ttgtttctgattgtttttgaacgaaaggggagaaaagcctGTG     ..................................................................................................................