                                                                        Gene putatively regulated by attenuation in B_halodurans

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:97 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-14.90 kcal/mol
Antiterminator: Size=50 nt.     Delta G=-13.60 kcal/mol
Anti-antiterminator:   Size=68 nt.     Delta G=-13.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCTGAAGGAAACATGTCAAGCGTTACATGATGACGATTTAGCGCGGTGGATTCCTTAT
GAGGAAGAAAGACAAGCGACGATCCGTTGGGGGCTTTGGCATATGGCAGACCACCATC
GCTACCATCAAGCTCATATTAACCGTTTACGATTATCGTATGCCAAAGGGGAAATGGG
CTCACTCTGAaaaagggtgggcttttttttgatttgaaagaattttgtcgaatttgattatttatgattgattttgactgaaagtgattgtat
actctaaataagaagtcgtatgaggtgtgtcctATG

    BH0826 --- fruB --- fruA Gene: BH0826     GI: 15613389     BI number: BH0826     GOG: COG1349     Description: transcriptional repressor Gene: fruB     GI: 15613390     BI number: BH0827     GOG: COG1105     Description: fructose 1-phosphate kinase Gene: fruA     GI: 15613391     BI number: BH0828     GOG: COG1299,COG1445,COG1762     Description: PTS system, fructose-specific enzyme II, BC componen   A G  C A  C C  A GC GC TA AT T  C A  | CG GC GT TA         T |  C      T  A |  C      A  T |  A       GC |  T       CG |  C       AT TA        TA TA       T  T CG        TG GC        GC GT       |  C GC       |  A |  A      |  A |  T      |  A |  A       CG         a G  T       CG       A  a GT       A  G      G  a TA       A  G       Ta TA        TA        Cg GC        TA        Tg C  |      A  |       Cg C  |       TA        At T  |       AT        Cg A  |       CG        Tg GC        TG        Cg CG        CG        Gc AT        GC        Gt GT        AT        Gt                         ttttttgatttgaaagaattttgtcgaatttgattatttatgattgattttgactgaaagtgattgtatactctaaataagaagtcgtatgaggtgtgtcctATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [KG] COG1349 Transcriptional regulators of sugar metabolism ... can be seen here [G] COG1105 Fructose-1-phosphate kinase and related fructose-6-phosphate kinase (PfkB) ... can be seen here [G] COG1299 Phosphotransferase system, fructose-specific IIC component ... can be seen here [G] COG1445 Phosphotransferase system fructose-specific component IIB ... can be seen here [GT] COG1762 Phosphotransferase system mannitol/fructose-specific IIA domain (Ntr-type) ... can be seen here     ..................................................................................................................