                                                                        Gene putatively regulated by attenuation in B_halodurans

This operon is putativelly rgulated by Thiamine_Thi-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:2 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-12.70 kcal/mol
Antiterminator: Size=67 nt.     Delta G=-21.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

agaaaagctgcatcaaaagatagacttttgatgcagctccttttcatttcaaatggttggagacgtcgacaaggaaagaaaaaacaataccattccgact
caacttatgctaggataaatgagaaaataaaacatgtataaccactaggggtgtcgaaagactgagagaggcgaatcctcaactcttggaacctgatcta
gttcatactagcgaagggaagtggcgcatttcgtgaaaactagtttacgataatcagtcaatgcggcatctccttgtgggtaggaaggagatgttttttc
ATG

    BH0830 Gene: BH0830     GI: 15613393     BI number: BH0830     GOG: COG3859     Description: ct a  a a  g at at gt ta gc cg ta |  t |  a |  a |  t |  c |  a |  g |  t |  c ta ta at cg gc         g cg       g  t g  g      g  a gc       t  g ta       g  g g  t       ta a  c       ta at        cg gc        cg gc        ta gt        cg at        ta a  g       at gt        cg cg        gt             tttttcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG3859 Predicted membrane protein ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Thiamine_Thi-box sequence ... can be seen here     ..................................................................................................................