                                                                        Gene putatively regulated by attenuation in B_halodurans

This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:21 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G=-20.60 kcal/mol
Antiterminator: Size=41 nt.     Delta G=-10.11 kcal/mol
Anti-antiterminator:   Size=52 nt.     Delta G=-15.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
The T-box sequence: agagtggtaccgcg is shown in italic-bold style

cagatggcgtgggctctgttaaaatgctcgataactgaatcgcgtgaacgttaaagattgggagagtacttttaccgaaagtcataaaagcgagtcggga
tggtgggagccgattggactggtgaaaggaaacgcacccatgaaatggcctgttgaataaaagtagacaggtccggtttgtcaccgttatgtgcatcaag
tgactcacaaatgagtaacgagagtggtaccgcgggtaaaagctcgcctctttttagaagaggcgggttttttattttattgtagaaaggattggttagg
ATG

    BH0834 Gene: BH0834     GI: 15613397     BI number: BH0834     GOG: COG0018     Description: arginine-tRNA ligas aa c  a at cg ta        aa cg       a  a at        tg g  a       gc ta        gt gc        gc a  g       cg         t a  a       gc       t  a cg       c  |       tg ta       c  |       ta |  g      a  |       ta |  t      t  |       cg a  g      g  |       ta cg       g  |       cg gt       t  |       cg ta        gc        gc gc        at        cg t  c       gc        tg a  |       at        cg t  |       gt        gt tg       c  t       at gc        at        at cg        at        at cg        ta        at                         tattttattgtagaaaggattggttaggATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0018 Arginyl-tRNA synthetase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_halodurans This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:28 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-17.30 kcal/mol Antiterminator: Size=41 nt.     Delta G=-10.11 kcal/mol Anti-antiterminator:   Size=59 nt.     Delta G=-12.90 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case The T-box sequence: agagtggtaccgcg is shown in italic-bold style cagatggcgtgggctctgttaaaatgctcgataactgaatcgcgtgaacgttaaagattgggagagtacttttaccgaaagtcataaaagcgagtcggga tggtgggagccgattggactggtgaaaggaaacgcacccatgaaatggcctgttgaataaaagtagacaggtccggtttgtcaccgttatgtgcatcaag tgactcacaaatgagtaacgagagtggtaccgcgggtaaaagctcgcctctttttagaagaggcgggttttttattttattgtagaaaggattggttagg ATG     BH0834 Gene: BH0834     GI: 15613397     BI number: BH0834     GOG: COG0018     Description: arginine-tRNA ligas   c a  t gc ta gc a  a a  a c  | ta at cg        cg g  a      c  c t  |       ag g  |       tg tg        gg at        gt ta        ta ta        ga gc       a  | cg       g  | |  a      a  |        t |  g      g  |      t  a |  a      c  |       tg cg       a  |       ta at       a  |       ta cg        ta        cg tg        ga        ta g  t       ag        cg t  |       gc        cg t  |       tt        gc ta       a  c       cg gc        ag        tg gc        ac        cg cg        cc        gt                         tttttattttattgtagaaaggattggttaggATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0018 Arginyl-tRNA synthetase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here     ..................................................................................................................